Chunjing An#, Dongxiong Hu#, Xiang Wang, Weidong Yang, Jiesheng Liu, Hongye Li, Srinivasan Balamurugan*
Key Laboratory of Eutrophication and Red Tide Prevention of Guangdong Higher Education Institute, College of Life Science and Technology, Jinan University, Guangzhou 510632, China.
Srinivasan Balamurugan, Email: bala.svm@gmail.com.
# These authors have contributed equally to this work.
Received 27-09-2017; received in revised form 12-12-2017; accepted 07-02-2018
Abstract Microalgal biofuels have been considered an attractive bioenergy resource because of incessant consumption of depleting fossil fuels. Genetically-engineered microalgal strains have been shown to hyper-accumulate neutral lipids. Microalgal lipogenesis is being regulated by multiple factors and metabolic nodes, making the identification of metabolic target a challenge. We identified a lipid-binding domain (LBD) steroidogenic acute regulatory protein related lipid transfer (START) and tested its functional role in model oleaginous heterokont Nannochloropsis oceanica. The introduced LBD was successfully integrated, transcribed, and expressed in transgenic microalgaeas shown in molecular analyses. In addition, the neutral lipid content of the LBD-overexpressing lines was increased significantly by 1.0-fold from that of wild type as incicated in lipidomic analysis. The volume of lipid droplets was concomitantly increased in the transgenic lines as presented in laser scanning confocal microscopy. The content of stearic acid was reduced; whereas the polyunsaturated fatty acid content was increased as revealed in fatty acid composition analysis. Therefore, this study provides an insight to the understanding of the function of LBD in regulating fatty acid and lipid metabolism in oleaginous microalgae.
Keywords: Nannochloropsis; biofuels; biosynthesis; lipid accumulation; lipid binding domain START
1. Introduction
Incessant consumption of depleting fossil fuel reserves and their negative impact on global climate change have necessitated the generation of alternative biofuel sources from sustainable and biological feedstock. Photosynthetic microalgae have emerged as the promising candidate for lipid overproduction over terrestrial plants because of their rapid growth rate, non-encroachment of arable land, non-competitive with edible crops, higher oleaginicity and capability to grow in wide range of waters (Chisti 2007; Foley 2011). At present, frequently used microalgae for lipid overproduction are Phaeodactylum tricornutum, Chlorella, Dunaliella, Scenedesmus obliquus, Nannochloropsis etc. These microalgae are widely distributed in marine and terrestrial natural waters, in which they grow well in a wide range of environmental conditions. In addition, they could accumulate lipids more than 50% of their dry weight in the stationary phase of their growth cycle (Chen et al. 2011; Chen et al. 2016). Nannochloropsis species are unicellular photosynthetic microalgae in size of 2-4 μm and widely distributed in fresh, marine, and brackish waters. Nannochloropsis sp. is a potential model candidate for lipid overproduction by genetic engineering due to rapid growth and lipid accumulation ability up to 70% of the dry weight under unfavorable conditions (Hodgson et al. 1991; Huerlimann et al. 2010). Previous on genetic engineering of Nannochloropsis focuse on overexpressing key genes involved in TAG biosynthetic pathway (Li et al. 2016). The advent of completely sequenced genome and the availability of bioinformatic data on the lipid-binding domain (LBD) START have predicted its function of lipid accumulation (Ponting and Aravind 1999). Reportedly, these proteins feature a START domain that has hydrophobic structure, and can bind and transfer fatty acids (Murcia et al., 2006). Schrick et al. (2014) discussed the functional domain, and the common features of these START proteins in Arabidopsis and mammals that could regulate fatty acid metabolism. However, the functional significance of the START domain in microalgae is yet to be characterized. In this study, we identified an LBD START and elucidated its role in lipid accumulation in oleaginous heterokont.
2. Materials and methods
2.1 Strain and culture conditions
Nannochloropsis oceanica IMET1 was obtained from Research Center of Red Tide and Marine Biology, Jinan University (Guangzhou, China) and cultivated as batch cultures in f/2 medium without Na2SiO3∙9H2O. The natural seawater with f/2 medium was filter-sterilized through a 0.22 μm membrane and utilized for microalgae cultivation. N. oceanica was grown at 25±1°C in an artificial climate incubator provided with cool-white fluorescence light of 200 μmol photons m-2s-1 under 12/12 h light/dark.
2.2 Cloning, vector construction and algae transformation
The 1059-bp full-length LBD START coding region from N. oceanica was PCR amplified with primers: LBD-F and LBD-R (Table1) and the resultant full-length LBD were cloned into a previously constructed vector pNA03 by homologous recombination using ClonExpress II One Step Cloning kit (Vazyme, China). The gene was cloned under the control of endogenous promoter, with homologous recombination connection sites. In addition, the vector also comes with ampicillin and zeocin resistance genes that were used to screen the transformants. The recombinant expression vector pNa03-LBD (Fig.1A) was electroporated into N. oceanica by using Bio-Rad GenePulser Xcell apparatus (Bio-Rad, USA) as per the protocol by Xue et al. (2015).
The transformed algal cells were transferred into liquid medium and cultured in shakers in dark for 24 h, and then were transferred into the solid selection medium supplemented with zeocin (5 μg/mL). The growing putative transformed cells in the selection medium were picked and grown in liquid medium with zeocin (10 μg/mL) and subcultured every week.
Table 1 Primers for PCR
|
Primer |
Sequence (5’→3’) |
|
LBD-F |
ACAATTACAATCCAGTGGTACCATGCTGGCACGTCTATTGTTTGT |
|
LBD-R |
GTCCTTGTAGTCCAGGTGTGTTTGATCCAGCAGTTCCCCAAACC |
|
Pt95F |
ACAATTACTATTTACAATTACAATCCAGTG |
|
Pt97R |
AAACCAMCATAAGCGGAGTGACTGCAAC |
|
LBD-qF |
GGTTGCAGCGCTGATATCTC |
|
LBD-qR |
CGTCTCAACTGCCGAATCAA |
2.3 Detection of transgenic microalgae by molecular approaches
The integration of the gene into transgenic cells was confirmed by genomic PCR. Genomic DNA was extracted from algal cells using Plant DNA kit (Omega, USA) and used as the template for PCR to detect the integration of CAT gene present in the pNa03-LBD using CAT gene primers Pt95F and Pt97R (Table 1). After the completion of the amplification, the product was verified by sequencing analysis.
The transcription abundance of LBD was quantified by quantitative real-time PCR (qPCR) using SYBR Green qPCR SuperMix (Invitrogen, USA) on ABI PRISM® 7500 Sequence Detection System (ABI, USA). Total RNA was prepared from transforme and WT cells using RNAiso plus kit (TaKaRa, Japan), first strand cDNA was prepared using the PrimeScript II 1st Strand cDNA Synthesis Kit (TaKaRa, Japan). The reactions were performed in 8 strip PCR tubes in a reaction volume of 20 μL following the manufacture’s instruction (ABI, USA). The native β-actin gene was used as the reference gene with the forward primer LBD-qF and reverse primer LBD-qR (Table1). The threshold cycle (Ct) value for LBD in algae cells were then normalized by using the corresponding reference gene.
The neutral lipid content of N. oceanica was determined by Nile red (Sigma Aldrich, USA) staining according to previous protocol with a slight modification (Yang et al. 2013). Briefly, 400 μL of algal culture, 100 μL glycerite (0.5 g/mL), and 5 μL of Nile red (3%) were added into a new 1.5 mL Eppendorf tube, then mixed by rapid inversion and incubated in dark at room temperature for 5 min. The relative content of neutral lipids in algae was detected inflow cytometry at excitation wavelength of 488 nm and emission wavelength of 575 nm.
2.5 Fatty acid composition analysis
Total fatty acids were extracted from algae cells and transesterified according to Lepage and Roy (1984) with modifications. Fatty acid composition was analyzed by Gas Chromatography-Mass Spectrometry (GC-MS) and used by the equipped NIST/EPA/HIH spectrum library 2.0. The integrated peak areas were determined and calculated by normalization to obtain the percent contents of fatty acid composition.
2.6 Morphological observation of microalgae
To analyze the oil storage places, oil bodies, in N. oceanica, algae cells were stained with Nile red fluorescence dye and observed under a fluorescence microscope. One milliliter microalgal cells were condensed into 100 μL, added with 25 μL glycerite (0.5 g/mL) and 8 μL of 3% Nile red and incubated in darkness for 10 min. A laser-scanning confocal microscope Zeiss LSM 510meta (Zeiss, Germany) with excitation wavelength of 488 nm and emission wavelength of 575 nm was used to observe the morphology of the stained algal cells.
3. Results and discussion
3.1 Isolation and analysis of LBD
A BLAST searching (http://www.ncbi.nlm.nih.gov/) was performed against the conserved amino acid sequence of LBD of N. gaditana (GenBank accession: EWM28098.1) as a query in N. oceanica genome. The amino acid sequence of putative LBD in N. oceanica showed high similarity to other 15 species obtained from NCBI by BLAST searching. The phylogenetic tree (Fig.1B) was constructed by MEGA5 and showed homology with LBDs of other species, especially a close cluster with N. gaditana. Multiple alignment of putative LBD against annotated LBD in Phaeodactylum tricornutum, Thalassiosira pseudonana, and Arabidopsis thaliana was conducted by Cluster Omega and showed a similarity to each other (Fig.1C). In addition, the LBD gene was identified, isolated, and cloned into the expression vector pNa03 under the control of endogenous promoter Hsp20. An omega leader motif was cloned in between the promoter (Hsp20) and the transgene NoLBD to enhance the translation of the transgene. The schematic recombinant vector map of pNa03-NoLBD is shown in Fig.1A.
Fig.1 Schematic map of the expression vector pNa03-LBD, phylogenetic relationship and multiple alignment of NoLBD. (A) Schematic map of the recombinant plasmid pNa03-LBD (B) Amino acid sequences of GPATs from various species were analyzed with software MEGA6 All the amino acid sequences from other species were obtained from NCBI based on BLAST and analyzed by MEGA5; (C) Multiple sequence alignment of the deduced LBD amino acid sequence from various species.
3.2 Molecular analysis of LBD overexpressing microalgae
To confirm the integration of introduced LBD gene into the host genome, genomic PCR was performed. As shown in Fig.2A, the specific PCR band was detected in the overexpression lines, while no such band was detected in WT. Further, the amplicon was sequenced, which reveals that NoLBD was successfully integrated into the host algal genome. The relative mRNA level of NoLBD was measured in the transgenes by qPCR. As shown in Fig.2B, the relative transcript level of NoLBD was significantly increased in the overexpression lines than that of WT. These results indicate that the recombinant vector had been successfully transformed into N. oceanica.
Fig.2 Molecular characterization of engineered N. oceanica. (A) PCR verification; (B) qPCR analysis of LBD in N. oceanica. Significant difference between control and treatment groups is indicated at P< 0.05 (*) or P< 0.01 (**) level. Each value represents means ± SD (n=3).
3.3 Growth curve and lipid analysis of N. oceanica
To examine the impact of LBD overexpression on the physiological characteristics of the transgenic N. oceanica, we determined the algal growth rate. As shown in Fig.3A, there was no significant difference observed between overexpression line and WT, and both strains reached the stationary phase on the 10th day of the growth phase. In order to determine the impact of LBD on microalgal lipid accumulation, neutral lipid content was determined in Nile red fluorometry (Fig.3B), which shows that neutral lipid content was increased by 1.0-fold in overexpression lines from that of WT. Meanwhile, it was reported that LBD plays as a role of transporter protein in binding fatty acid molecules and facilitating its transport (Farese and Walther 2009), in which fatty acids are often accumulated in the stationary phase of growth. Once the cells attained the stationary phase, the engineered algae strain would accumulate more neutral lipids than that of WT. This functional role could attribute to the lipid accumulation in LBD over expressing lines without impairing cellular growth rate.
Fig.3 Growth curve and neutral lipid content of microalgae. (A) Growth curves; (B) Neutral lipid content of microalgae determined by Nile red staining. Significant difference between control and treatment groups is indicated at P< 0.05 (*) or P< 0.01 (**) level. Each value represents means ± SD (n=3).
Fig.4 Composition of fatty acid in microalgae. Significant difference between control and treatment groups is indicated at P< 0.05 (*) or P< 0.01 (**) level. Each value represents means ± SD (n=3).
Further, we determined the fatty acid composition of the overexpression lines by GC-MS. Interestingly, we found that LBD promoted31% higher the accumulation of C20:5 from that of WT. Furthermore, C20:4 was not detected in the overexpression lines although it occupied almost 4% in WT. Hence, the overexpression of LBD would decrease the contents of these fatty acids. It therefore can be inferred that the overexpression of oil body-associated protein LBD could reduce the intracellular content of stearic acid and in turn could facilitate the synthesis of palmitic acid and polyunsaturated fatty acids (C20:5) (Fig.4).
As the lipidomic analysis shown, neutral lipid content was significantly increased in the overexpression lines (Fig.3B). Interestingly, the fatty acid composition of the overexpression lines was altered (Fig.4). Altogether, these results demonstrate that LBD with START functional domain enhanced the lipid transportation, and resulted in the elevation of lipid content (Fig.3B). The molecular mechanism of LBD underlying the lipid transportation and hyper-accumulation warrants further investigation.
Fig.5 Confocal microscope analysis of transgenic and wild type N. oceanica. (A) WT; (B) transgenic algae
3.4 Morphological observation of transformed N. oceanica
To further assess the morphology of cells and lipid droplets, we observed the Nile red stained cells in laser scanning confocal microscope. As shown in Fig.5, the volume of lipid droplets was concomitantly increased in the transgenic lines, while the cellular morphology was not affected by NoLBD overexpression. These lipidomic analyses revealed that NoLBD gene played a pivotal role in accumulating lipid content in the stationary phase of transgenic lines. Calderon-Dominguez et al. (2014) reported that the protein with START (StarD4) domain plays a crucial role in the transport of cholesterol in human and found that protein possesses the lipid-binding crevice.
4. Conclusions
We identified and over expressed an LBD in N. oceanica and demonstrated the significance of LBD in lipid accumulation. The overexpression of LBD resulted in significant elevation of lipid content and remarkably altered the fatty acid composition. For the first time, we elucidated the role of LBD in microalgal lipid accumulation.
Acknowledgments
This work gain financial supports from the Nature Science Foundation of China (No. 41576132), and the Guangdong Provincial Natural Science Foundation (No. 2014A030308010).
References
Calderon-Dominguez M, Gil G, Medina MA, et al. (2014). The stard4 subfamily of steroidogenic acute regulatory-related lipid transfer (start) domain proteins: New players in cholesterol metabolism. Int. J. Biochem. Cell Biol. B. 49:64-68.
Chen CY, Yeh KL, Aisyah R, et al. (2011). Cultivation, photobioreactor design and harvesting of microalgae for biodiesel production: A critical review. Bioresour. Technol. 102(1):71-81.
Chen JW, Liu WJ, Hu DX, et al. (2016). Identification of a malonyl coa-acyl carrier protein transacylase and its regulatory role in fatty acid biosynthesis in oleaginous microalga nannochloropsis oceanica. Biotechnol. Appl. Biochem. doi:10.1002/bab.1531.
Chisti Y. (2007). Biodiesel from microalgae. Biotechnol. Adv. 25(3):294-306.
Farese RV Jr, Walther TC. (2009). Lipid Droplets Finally Get a Little R-E-S-P-E-C-T. Cell 139(5):855-860.
Foley JI. (2011). Use of mineral trioxide aggregate (MTA by postgraduates in restorative dentistry in the UK. Eur. J. Prosthodont. Restor. Dent. 19(4):179-183.
Heimann K, Huerlimann R, de Nys R. (2010). Growth, lipid content, productivity, and fatty acid composition of tropical microalgae for scale-up production. Biotechnol. Bioeng. 107(2):245–257.
Hodgson PA, Henderson RJ, Sargent JR, et al. (1991). Patterns of variation in the lipid class and fatty acid composition of Nannochloropsis oculata (Eustigmatophyceae) during batch culture. J. Appl. Phycol. 3(2): 169-181.
Lepage G, Roy CC. (1984). Improved recovery of fatty acid through direct transesterification without prior extraction or purification. J. Lipid Res. 25(12):1391-1396.
Li DW, Cen SY, Liu YH, et al. (2016). A type 2 diacylglycerol acyltransferase accelerates the triacylglycerol biosynthesis in heterokont oleaginous microalga Nannochloropsis oceanica. J. Biotechnol. 229:65-71.
Ponting CP, Aravind L. (1999). Start: A lipid-binding domain in star, hd-zip and signalling proteins. Trends Biochem. Sci. 24(4):130-132.
Schrick K, Bruno M, Khosla A, et al. (2014). Shared functions of plant and mammalian star-related lipid transfer (start) domains in modulating transcription factor activity. BMC Biol. 12:70.
Xue J, Niu YF, Huang T, et al. (2015). Genetic improvement of the microalga Phaeodactylum tricornutum for boosting neutral lipid accumulation. Metab Eng. 27:1-9.
Yang ZK, Niu YF, Ma YH, et al. (2013). Molecular and cellular mechanisms of neutral lipid accumulation in diatom following nitrogen deprivation. Biotechnol. Biofuels 6(67):1-67.
